SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore coat protein, necessary for the proper localization of [protein|49ED84B48CEC09493B6056D03D2A57578770CE15|CwlJ]
20.13 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
spore [category|SW 4.2.4|Germination]
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    3,893,441 3,893,986

    The protein


  • cross-linked by [protein|A46D07F8F56249A04C5F880120D19F00C9CAE112|YabG] and [protein|4A2B1DA38608E5A4096087BF7246D4C64C54DBE3|Tgl] at higher temperatures that induce germination [Pubmed|16751597]
  • [SW|Localization]

  • inner spore coat [Pubmed|19933362]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190]
  • view in new tab

    Biological materials


  • MGNA-B671 (ywdL::erm), available at the [ NBRP B. subtilis, Japan]
  • 1G18 ( ''gerQ''::''spec''), [Pubmed|12644503], available at [ BGSC]
  • BKE37920 ([gene|1CA990DA55B6F879968C431A703E0478F5564A1A|gerQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTTCCTCCTTTTTA, downstream forward: _UP4_TAAGAAAAAAGCCAATCACT
  • BKK37920 ([gene|1CA990DA55B6F879968C431A703E0478F5564A1A|gerQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTTCCTCCTTTTTA, downstream forward: _UP4_TAAGAAAAAAGCCAATCACT
  • References

  • 19933362,15317760,16936016,12644503,16267299,16751597,15699190,30958830,28870294,31871031