SubtiBank SubtiBank
gerQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerQ

spore coat protein, necessary for the proper localization of [protein|49ED84B48CEC09493B6056D03D2A57578770CE15|CwlJ]
locus
BSU37920
pI
7.01
mw
20.13 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
spore [category|SW 4.2.4|Germination]
product
spore coat protein
essential
no
synonyms
ywdL,ipa-62r

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    3,893,441 3,893,986

    The protein

    Modification

  • cross-linked by [protein|A46D07F8F56249A04C5F880120D19F00C9CAE112|YabG] and [protein|4A2B1DA38608E5A4096087BF7246D4C64C54DBE3|Tgl] at higher temperatures that induce germination [Pubmed|16751597]
  • [SW|Localization]

  • inner spore coat [Pubmed|19933362]
  • Expression and Regulation

    Operons

    genes
    [gene|1CA990DA55B6F879968C431A703E0478F5564A1A|gerQ]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B671 (ywdL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1670 NBRP B. subtilis, Japan]
  • 1G18 ( ''gerQ''::''spec''), [Pubmed|12644503], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G18&Search=1G18 BGSC]
  • BKE37920 ([gene|1CA990DA55B6F879968C431A703E0478F5564A1A|gerQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTTCCTCCTTTTTA, downstream forward: _UP4_TAAGAAAAAAGCCAATCACT
  • BKK37920 ([gene|1CA990DA55B6F879968C431A703E0478F5564A1A|gerQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTTCCTCCTTTTTA, downstream forward: _UP4_TAAGAAAAAAGCCAATCACT
  • References

  • 19933362,15317760,16936016,12644503,16267299,16751597,15699190,,28870294