SubtiBank SubtiBank
alaR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

alaR

transcriptional regulator ([SW|Lrp family]) of the [gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]-[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT] operon
locus
BSU_31410
pI
4.89
mw
18.62 kDa
protein length
166 aa Sequence Blast
gene length
501 bp Sequence Blast
function
unknown
product
transcription regulator ([SW|Lrp family])
essential
no
synonyms
yugG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,226,933 3,227,433

    The protein

    Protein family

  • ([SW|Lrp family])
  • Modification

  • phosphorylated on Arg-79 [Pubmed|22517742]
  • Expression and Regulation

    Operons

    genes
    [gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]-[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]
    description
    [Pubmed|22383849]

    additional information

  • A [protein|search|ncRNA] is predicted between [gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI] and [gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A622 (yugG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/622 NBRP B. subtilis, Japan]
  • BKE31410 ([gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATTCACACCTTTGC, downstream forward: _UP4_AAAAGAATCGTGGTGTCACC
  • BKK31410 ([gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATTCACACCTTTGC, downstream forward: _UP4_AAAAGAATCGTGGTGTCACC
  • References

  • 22517742,22383849