SubtiBank SubtiBank
yheB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yheB

unknown
locus
BSU_09790
pI
9.31
mw
42.75 kDa
protein length
377 aa Sequence Blast
gene length
1134 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,053,520 1,054,653

    The protein

    Protein family

  • UPF0754 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1C9A6D2B53B9E66F3FBBB536E02ACA52E0A96646|yheB]-[gene|1C3BD9F0863F0C7DDB22EEF7FF4B1D50BED8A797|yheA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B495 (yheB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1494 NBRP B. subtilis, Japan]
  • BKE09790 ([gene|1C9A6D2B53B9E66F3FBBB536E02ACA52E0A96646|yheB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTATTCATCTTCCTC, downstream forward: _UP4_TAAGAAGAAATGGTTTTTGA
  • BKK09790 ([gene|1C9A6D2B53B9E66F3FBBB536E02ACA52E0A96646|yheB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTATTCATCTTCCTC, downstream forward: _UP4_TAAGAAGAAATGGTTTTTGA
  • References

  • 22383849