SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


13.96 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,984,312 2,984,695

    The protein

    Protein family

  • UPF0716 (fxsA) family (single member, according to UniProt)
  • [SW|Localization]

  • Membrane (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation




  • twofold induced by glucose [Pubmed|11489127]
  • view in new tab

    Biological materials


  • MGNA-B523 (ytzA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29170 ([gene|1C6D935B36416327FE63CABC53440441E8563D7E|ytzA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAAGCCCCCCACAC, downstream forward: _UP4_TAAAAAACGGCAGCCATGAA
  • BKK29170 ([gene|1C6D935B36416327FE63CABC53440441E8563D7E|ytzA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAAGCCCCCCACAC, downstream forward: _UP4_TAAAAAACGGCAGCCATGAA
  • References

  • 16479537,11489127