SubtiBank SubtiBank
ytzA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytzA

unknown
locus
BSU_29170
pI
10.11
mw
13.96 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,984,312 2,984,695

    The protein

    Protein family

  • UPF0716 (fxsA) family (single member, according to UniProt)
  • [SW|Localization]

  • Membrane (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]-[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]-[gene|1C6D935B36416327FE63CABC53440441E8563D7E|ytzA]
    description
    [Pubmed|11489127]

    regulation

  • twofold induced by glucose [Pubmed|11489127]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B523 (ytzA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1522 NBRP B. subtilis, Japan]
  • BKE29170 ([gene|1C6D935B36416327FE63CABC53440441E8563D7E|ytzA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAAGCCCCCCACAC, downstream forward: _UP4_TAAAAAACGGCAGCCATGAA
  • BKK29170 ([gene|1C6D935B36416327FE63CABC53440441E8563D7E|ytzA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAAGCCCCCCACAC, downstream forward: _UP4_TAAAAAACGGCAGCCATGAA
  • References

  • 16479537,11489127