SubtiBank SubtiBank
flgB

flgB

flagellar basal-body rod protein, required for the assembly of the flagellar hook and filament
locus
BSU_16180
pI
5.16
mw
14.30 kDa
protein length
129 aa Sequence Blast
gene length
390 bp Sequence Blast
function
movement and chemotaxis
product
flagellar basal-body rod protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,691,278 1,691,667

    Phenotypes of a mutant

  • defective in swarming and flagellar assembly [pubmed|30201778]
  • The protein

    Protein family

  • [SW|Flagella basal body rod proteins family] (according to UniProt)
  • [SW|Localization]

  • bacterial flagellum basal body (according to Swiss-Prot), extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]-[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]-[gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]-[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]-[gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]-[gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]-[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]-[gene|600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC|fliJ]-[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
    description
    [Pubmed|9657996,8157612,15175317]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • a ''flgB::erm'' mutant is available in [SW|Linc Sonenshein]'s lab
  • 1A922 ( ''flgB''::''erm''), [Pubmed|12813063], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A922&Search=1A922 BGSC]
  • BKE16180 ([gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCACTTACCTCCATT, downstream forward: _UP4_ACCGTATTAACAGGAGGAAA
  • BKK16180 ([gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCACTTACCTCCATT, downstream forward: _UP4_ACCGTATTAACAGGAGGAAA
  • References

  • 17850253,1905667,14651647,18957862,9657996,8157612,15175317,24386445,30201778