SubtiBank SubtiBank
gntR
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

gntR

transcriptional repressor (GntR family) of the gntR-gntK-gntP-gntZ operon
locus
BSU40050
pI
5.26
mw
28.13 kDa
protein length
243 aa Sequence Blast
gene length
729 bp Sequence Blast
function
regulation of gluconate utilization
product
transcriptional repressor of the gluconate operon
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.13|Utilization of gluconate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    4,113,417 → 4,114,148

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Effectors of protein activity

  • gluconate acts as molecular inducer
  • Expression and Regulation

    Operons

    genes
    [gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]-[gene|72404FA6ECD62AEA3EFDB934DFB8DA581875605C|gntK]-[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]-[gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]
    description
    [pubmed|10746760,3020045]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3020045], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR]: repression, [Pubmed|3020045], in [regulon|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by gluconate ([protein|search|GntR]) [Pubmed|3020045]
  • view in new tab

    Biological materials

    Mutant

  • BKE40050 (Δ[gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACTCACCTTCCTCAC, downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA
  • BKK40050 (Δ[gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACTCACCTTCCTCAC, downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA
  • References

  • 8370661,8808939,8288545,7642511,7476858,8596444,3011959,2163901,3037520,2492998,9106211,2419835,2124676,3020045,10746760,8510140,2843515,7476858,3020045,1659648,21106498,22900538,220817675,27829583