SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional repressor (GntR family) of the gntR-gntK-gntP-gntZ operon
28.13 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast
regulation of gluconate utilization
transcriptional repressor of the gluconate operon

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of gluconate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    4,113,417 4,114,148

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 17-83) (according to UniProt)
  • Effectors of protein activity

  • gluconate acts as molecular inducer
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3020045], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR]: repression, [Pubmed|3020045], in [regulon|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by gluconate ([protein|search|GntR]) [Pubmed|3020045]
  • view in new tab

    Biological materials


  • BKE40050 ([gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACTCACCTTCCTCAC, downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA
  • BKK40050 ([gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACTCACCTTCCTCAC, downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA
  • References

  • 8370661,8808939,8288545,7642511,7476858,8596444,3011959,2163901,3037520,2492998,9106211,2419835,2124676,3020045,10746760,8510140,2843515,7476858,3020045,1659648,21106498,22900538,220817675,27829583