SubtiBank SubtiBank
sfp/1
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sfp/1

4-phosphopantetheinyl transferase (surfactin synthetase-activating enzyme), required for production of surfactin, plipastatin and bacillaene, inactive pseudogene in strain 168
locus
BSU03569
pI
0.00
mw
0.00 kDa
protein length
gene length
168 bp Sequence Blast
function
phosphopantetheinylates a serine residue in each of the seven peptidyl carrier protein domains of the first three subunits of surfactin synthetase (SrfAA-SrfAB-SrfAC) and AcpK
product
4-phosphopantetheinyl transferase
essential
no
synonyms
sfp

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    407,460 407,627

    Phenotypes of a mutant

  • No swarming motility on B medium. [Pubmed|19202088]
  • The protein

    Catalyzed reaction/ biological activity

  • CoA + apo-[peptidyl-carrier protein] = adenosine 3',5'-bisphosphate + holo-[peptidyl-carrier protein] (according to Swiss-Prot)
  • Protein family

  • Gsp/sfp/hetI/acpT family (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE03569 ([gene|1C4F076D54F5A07AC351D722A403F249ED097555|sfp/1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03569 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGGTGCAGGCGCACTGAAA, downstream forward: _UP4_ACAATGGTCTCGTACGAAGA
  • BKK03569 ([gene|1C4F076D54F5A07AC351D722A403F249ED097555|sfp/1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03569 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGGTGCAGGCGCACTGAAA, downstream forward: _UP4_ACAATGGTCTCGTACGAAGA
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • References

    Reviews

  • 20735481
  • Original publications

  • 15955059,19202088,2848009,11489886,15065855,10581256,15066026,11867633,19202088,19749039,20094656,9484229,20148996,21278284,21466506,22773650,24826903,25002419