SubtiBank SubtiBank
yheA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yheA

glutamine-rich protein
locus
BSU09800
pI
4.41
mw
13.45 kDa
protein length
117 aa Sequence Blast
gene length
354 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,054,746 1,055,099

    The protein

    Protein family

  • UPF0342 family (according to Swiss-Prot)
  • Modification

  • phosphorylated on Arg-51 [Pubmed|22517742]
  • Structure

  • [PDB|2OEE]
  • Expression and Regulation

    Operons

    genes
    [gene|1C9A6D2B53B9E66F3FBBB536E02ACA52E0A96646|yheB]-[gene|1C3BD9F0863F0C7DDB22EEF7FF4B1D50BED8A797|yheA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B496 (yheA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1495 NBRP B. subtilis, Japan]
  • BKE09800 ([gene|1C3BD9F0863F0C7DDB22EEF7FF4B1D50BED8A797|yheA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTAAATAGCTCCTTTC, downstream forward: _UP4_TAATAAGCAAAATCCCTTCT
  • BKK09800 ([gene|1C3BD9F0863F0C7DDB22EEF7FF4B1D50BED8A797|yheA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTAAATAGCTCCTTTC, downstream forward: _UP4_TAATAAGCAAAATCCCTTCT
  • References

  • 22517742,22383849