SubtiBank SubtiBank
yheA

yheA

glutamine-rich protein
locus
BSU_09800
pI
4.41
mw
13.45 kDa
protein length
117 aa Sequence Blast
gene length
354 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,054,746 1,055,099

    The protein

    Protein family

  • UPF0342 family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-51 [Pubmed|22517742]
  • Structure

  • [PDB|2OEE]
  • Expression and Regulation

    Operons

    genes
    [gene|1C9A6D2B53B9E66F3FBBB536E02ACA52E0A96646|yheB]-[gene|1C3BD9F0863F0C7DDB22EEF7FF4B1D50BED8A797|yheA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B496 (yheA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1495 NBRP B. subtilis, Japan]
  • BKE09800 ([gene|1C3BD9F0863F0C7DDB22EEF7FF4B1D50BED8A797|yheA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTAAATAGCTCCTTTC, downstream forward: _UP4_TAATAAGCAAAATCCCTTCT
  • BKK09800 ([gene|1C3BD9F0863F0C7DDB22EEF7FF4B1D50BED8A797|yheA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTAAATAGCTCCTTTC, downstream forward: _UP4_TAATAAGCAAAATCCCTTCT
  • References

  • 22517742,22383849