SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


cystathionine beta-lyase
42.33 kDa
protein length
390 aa Sequence Blast
gene length
1170 bp Sequence Blast
biosynthesis of methionine
cystathionine beta-lyase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    1,259,606 → 1,260,778

    The protein

    Catalyzed reaction/ biological activity

  • L-cystathionine + H2O = L-homocysteine + NH3 + pyruvate (according to Swiss-Prot)
  • Protein family

  • trans-sulfuration enzymes family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|MccB], [protein|04DC792180FDC5E7916F2DBB2EC2C34369202FE0|MetI]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|4L0O] (from Helicobacter pylori, 51% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11832514], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|S-box|S-box]: transcription termination/ antitermination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination, in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B299 (yjcJ::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A944 ( ''metC''::''kan''), [Pubmed|11832514], available at [ BGSC]
  • 1A940 ( ''metC''::''spec''), [Pubmed|11832514], available at [ BGSC]
  • BKE11880 (Δ[gene|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|metC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGGGTTTCCAGCGTCCAAT, downstream forward: _UP4_TAAAAAAGAAGCCGGGGATA
  • BKK11880 (Δ[gene|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|metC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGGGTTTCCAGCGTCCAAT, downstream forward: _UP4_TAAAAAAGAAGCCGGGGATA
  • References

  • 19258532,11832514,18039762,12107147