SubtiBank SubtiBank
yydI
The papers of the month are back! Check them out! Link here

yydI

[SW|ABC transporter], ATP-binding protein, export of the mature [protein|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|YydF] epipeptide
locus
BSU40150
pI
8.39
mw
23.74 kDa
protein length
209 aa Sequence Blast
gene length
627 bp Sequence Blast
function
control of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]-[protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] activity
product
[SW|ABC transporter], ATP-binding protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.3|Export of peptides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,124,963 → 4,125,592

    The protein

    Structure

  • [PDB|4HLU] (aa 7- 175, Thermotoga maritima EcfA, 32% identity) [pubmed|23359690]
  • [SW|Localization]

  • membrane associated (via [protein|A4213DE6C9BE29405B0A4C0A969A78EA4C5EB71F|YydJ]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|yydF]-[gene|25FC87037222084ABE318813959101016FEB49DF|yydG]-[gene|E280A5994F4D9D93DA4B698E79C86360DBEE5396|yydH]-[gene|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|yydI]-[gene|A4213DE6C9BE29405B0A4C0A969A78EA4C5EB71F|yydJ]
    description
    [Pubmed|17921301]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17921301], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|17921301], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • activated after transition to stationary phase([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|17921301]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B808 (yydI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1807 NBRP B. subtilis, Japan]
  • BKE40150 (Δ[gene|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|yydI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACATACTCCTAGGAA, downstream forward: _UP4_TAATAAAACAGTGGGGGCTT
  • BKK40150 (Δ[gene|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|yydI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACATACTCCTAGGAA, downstream forward: _UP4_TAATAAAACAGTGGGGGCTT
  • References

    Reviews

  • 23106164
  • Original publications

  • 10092453,23199363,17921301,15743949,17921301,21815947,28644475,23359690