SubtiBank SubtiBank
ycnI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycnI

unknown
locus
BSU_03940
pI
4.83
mw
21.97 kDa
protein length
204 aa Sequence Blast
gene length
615 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    446,174 446,788

    The protein

    [SW|Localization]

  • cell membrane [pubmed|30602489]
  • Expression and Regulation

    Operons

    genes
    [gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]
    description
    [Pubmed|22904286,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22904286], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK]: repression, [Pubmed|22904286,19168619], in [regulon|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by copper limitation ([protein|search|YcnK]) [Pubmed|22904286,19168619]
  • view in new tab

    Biological materials

    Mutant

  • BKE03940 ([gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTAAACACTCCTTAAT, downstream forward: _UP4_TAATAAAGAAAGCGATCCAG
  • BKK03940 ([gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTAAACACTCCTTAAT, downstream forward: _UP4_TAATAAAGAAAGCGATCCAG
  • References

  • 22904286,22383849,30602489