SubtiBank SubtiBank
ydfJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydfJ

similar to antibiotic transport-associated protein
locus
BSU_05430
pI
5.18
mw
76.85 kDa
protein length
724 aa Sequence Blast
gene length
2175 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    589,717 591,891

    The protein

    Protein family

  • resistance-nodulation-cell division (RND) (TC 2.A.6) family (with [protein|1632474628BEA113F297897D152276A1AB73BAE8|YdgH] and [protein|AAC32230E3E585932A876737131C3E2C15168B2A|SwrC], according to UniProt)
  • Structure

  • [PDB|6N3T] (from Mycobacterium smegmatis, 25% identity) [pubmed|31113875]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI]: activation, [Pubmed|15941986], in [regulon|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C149 (ydfJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2147 NBRP B. subtilis, Japan]
  • BKE05430 ([gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAATCTCCTTTCAAC, downstream forward: _UP4_TAATAGAAAAAGCAGATCTT
  • BKK05430 ([gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAATCTCCTTTCAAC, downstream forward: _UP4_TAATAGAAAAAGCAGATCTT
  • References

  • 15941986,31113875