SubtiBank SubtiBank
ydbL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydbL

unknown
locus
BSU_04510
pI
9.14
mw
12.79 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    504,689 505,024

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C094 (ydbL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2092 NBRP B. subtilis, Japan]
  • BKE04510 ([gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGAGACACCTCCGTCA, downstream forward: _UP4_TAATCGCGCTGTTCCCTTGG
  • BKK04510 ([gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGAGACACCTCCGTCA, downstream forward: _UP4_TAATCGCGCTGTTCCCTTGG