The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
yceJ
similar to multidrug-efflux transporter
Genomic Context
categories
[category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters][category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity][category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]Gene
Coordinates
319,180 320,352
The protein
Protein family
[SW|major facilitator superfamily] (according to UniProt)[SW|Localization]
cell membrane (according to UniProt)Biological materials
Mutant
MGNA-C048 (yceJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2046 NBRP B. subtilis, Japan]BKE02960 ([gene|1AAC42E6E96DC358E79C75DB2BBB3E40353E1890|yceJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTTATCACTCCTATT, downstream forward: _UP4_TAAAAAAGCACCTCATTCAABKK02960 ([gene|1AAC42E6E96DC358E79C75DB2BBB3E40353E1890|yceJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTTATCACTCCTATT, downstream forward: _UP4_TAAAAAAGCACCTCATTCAAReferences