SubtiBank SubtiBank
yceJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yceJ

similar to multidrug-efflux transporter
locus
BSU_02960
pI
9.91
mw
41.80 kDa
protein length
390 aa Sequence Blast
gene length
1173 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    319,180 320,352

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C048 (yceJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2046 NBRP B. subtilis, Japan]
  • BKE02960 ([gene|1AAC42E6E96DC358E79C75DB2BBB3E40353E1890|yceJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTTATCACTCCTATT, downstream forward: _UP4_TAAAAAAGCACCTCATTCAA
  • BKK02960 ([gene|1AAC42E6E96DC358E79C75DB2BBB3E40353E1890|yceJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTTATCACTCCTATT, downstream forward: _UP4_TAAAAAAGCACCTCATTCAA
  • References

  • 27766092