SubtiBank SubtiBank
sunA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sunA

sublancin 168 is post-translationally modified antimicrobial precursor peptide from the glycocin class
locus
BSU21480
pI
7.96
mw
5.85 kDa
protein length
gene length
171 bp Sequence Blast
function
exported antimicrobial peptide
product
sublancin 168 antimicrobial precursor peptide
essential
no
synonyms
yolG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,269,521 2,269,691

    The protein

    Protein family

  • IPP isomerase type 2 family (according to Swiss-Prot)
  • Modification

  • contains a glucose attached to a cysteine residue, glycosylation is essential for its antimicrobial activity [Pubmed|21196935]
  • Structure

  • [PDB|2MIJ] [Pubmed|24405370]
  • [SW|Localization]

  • secreted [pubmed|21196935]
  • Expression and Regulation

    Operons

    genes
    [gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|260693EE7F5B5CE2A141149D292405E84B7A5FF4|sunT]-[gene|DB5F719C0A2F610301E174F6890DA9E826C76932|bdbA]-[gene|6B2DC9873B7B693D9D0FC0D773740140D0640C9E|yolJ]-[gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: activation, [Pubmed|20817675,19465659], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[SW|DnaA] [Pubmed|27902860,15743949]
  • expression starts in the stationary phase [pubmed|30808982]
  • expression is heterogeneous in the population, this is mediated by [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok], and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] [pubmed|30808982]
  • additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • the amount of the mRNA is substantially decreased upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    genes
    [gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]
    description
    [Pubmed|16306698]

    regulation

  • repressed by [protein|search|Rok]-[SW|DnaA] [Pubmed|27902860,15743949]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • GP1563 (aphA3), available in [SW|Jörg Stülke]'s labb
  • GP1565 (''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'', aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE21480 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT, downstream forward: _UP4_TAAAACATTTGTAGAGGGAA
  • BKK21480 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT, downstream forward: _UP4_TAAAACATTTGTAGAGGGAA
  • References

  • 27902860,12884008,9722542,15743949,17720793,16306698,19465659,21196935,24405370,22400495,20817675,21910430,25879813,26282429,26339632,29112373,30808982