SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


DNA damage checkpoint recovery protease, promotes DNA damage checkpoint recovery
38.61 kDa
protein length
341 aa Sequence Blast
gene length
1026 bp Sequence Blast
degradation of [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA]
DNA damage checkpoint recovery protease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,572,765 1,573,790

    Phenotypes of a mutant

  • deletion of [protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA] and [protein|1A5C1BDE844AA56B90C0E4A02D74978676487E99|DdcP] leads to accumulation of the checkpoint protein [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA] [pubmed|29979679]
  • sensitivity to DNA damage [pubmed|29979679]
  • The protein

    Protein family

  • Peptidase S16 family (with [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA] and [protein|CA90AAE5320C20F93F5ED0F167294C28495756FF|LonB], according to UniProt)
  • [SW|Domains]

  • TM helix (aa 9 - 29) [pubmed|29979679]
  • [SW|PDZ domain] (aa 100 - 186) [pubmed|29979679]
  • Lon protease domain (aa 187 - 336) [pubmed|29979679]
  • Structure

  • [PDB|2KJP] (PDZ domain)
  • [SW|Localization]

  • cell membrane, with extracellular protease domain [pubmed|30315724]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-B249 (ylbL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15050 ([gene|1A5C1BDE844AA56B90C0E4A02D74978676487E99|ddcP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTAAAATGTTTTTTACGTA, downstream forward: _UP4_CTGAAAGCGAAAAGCACCTG
  • BKK15050 ([gene|1A5C1BDE844AA56B90C0E4A02D74978676487E99|ddcP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTAAAATGTTTTTTACGTA, downstream forward: _UP4_CTGAAAGCGAAAAGCACCTG
  • References

    Research papers

  • 29979679,30315724