SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glutaminase, low affinity for glutamine
36.03 kDa
protein length
327 aa Sequence Blast
gene length
984 bp Sequence Blast
glutamine degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • Gene

    264,191 265,174

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L-glutamine --> L-glutamate + NH4+ (according to UniProt)
  • Protein family

  • glutaminase family (with [protein|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|YlaM], according to UniProt)
  • Paralogous protein(s)

  • [protein|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|YlaM]
  • Structure

  • [PDB|3BRM] [PDB|1MKI][Pubmed|18459799]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15995196], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL]: activation, [Pubmed|15995196], in [regulon|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL regulon]
  • regulation

  • induced in the presence of glutamine ([protein|search|GlnL]) [Pubmed|15995196]
  • view in new tab

    Biological materials


  • MGNA-B943 (ybgJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02430 ([gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAATTCCTCCTCACTG, downstream forward: _UP4_TAAACATGAAAAAAGAGGTG
  • BKK02430 ([gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAATTCCTCCTCACTG, downstream forward: _UP4_TAAACATGAAAAAAGAGGTG
  • References

  • 15995196,18459799