SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


molybdopterin precursor biosynthesis
38.39 kDa
protein length
341 aa Sequence Blast
gene length
1026 bp Sequence Blast
nitrate respiration

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of molybdopterin]
  • Gene

    3,772,325 3,773,350

    The protein

    Catalyzed reaction/ biological activity

  • involved in the first step of molybdenum cofactor biosynthesis (together with [protein|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|YdiG])
  • AH2 + GTP + S-adenosyl-L-methionine --> (8S)-3',8-cyclo-7,8-dihydroguanosine 5'-triphosphate + 5'-deoxyadenosine + A + H+ + L-methionine (according to UniProt)
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • S-adenosyl methionine (according to UniProt)
  • Structure

  • [PDB|1TV7] (from Staphylococcus aureus, 49% identity) [pubmed|15317939]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE36700 ([gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTAATCATAGCTACAGCCC, downstream forward: _UP4_TAATTTGAAGTCAAAAGCTT
  • BKK36700 ([gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTAATCATAGCTACAGCCC, downstream forward: _UP4_TAATTTGAAGTCAAAAGCTT
  • References


  • 23539623,25268953
  • Original publications

  • 7860592,9352926,15317939