SubtiBank SubtiBank
yxeK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxeK

N-acetyl S-(2-succino)cysteine oxygenase
locus
BSU_39520
pI
5.67
mw
49.18 kDa
protein length
441 aa Sequence Blast
gene length
1326 bp Sequence Blast
function
utilization and detoxification of S-(2-succino)cysteine
product
N-acetyl S-(2-succino)cysteine oxygenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.3|Conversion of S-(2-succino)cysteine to cysteine]
  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • Gene

    Coordinates
    4,060,818 4,062,143

    Phenotypes of a mutant

  • no growth with S-(2-succino)cysteine as the single source of sulfur [pubmed|29626092]
  • The protein

    Catalyzed reaction/ biological activity

  • oxygenation of N-acetyl S-(2-succino)cysteine [pubmed|29626092]
  • Protein family

  • ntaA/snaA/soxA(dszA) monooxygenase family (with [protein|8145952307BC47805A7A9BD39418474358043BFE|CmoJ], according to UniProt)
  • Paralogous protein(s)

  • [protein|8145952307BC47805A7A9BD39418474358043BFE|CmoJ]
  • Structure

  • [PDB|5TLC] (from B. subtilis WU-S2B 42% identity) [pubmed|28205250]
  • Expression and Regulation

    Operons

    genes
    [gene|19E6EF9CCA31440EAC046F8D6CA98B6A08589D58|yxeK]-[gene|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|snaB]-[gene|D96EEDABB73AC66E6AB772431819E7C767DC8B9A|yxeM]-[gene|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|yxeN]-[gene|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|yxeO]-[gene|C99AA3FDBB561BCED60915078DC746690C071753|sndB]-[gene|7DDB283173267AA106DC277787AAAB4F4F9975F4|yxeQ]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]) [Pubmed|16513748]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B709 (yxeK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1708 NBRP B. subtilis, Japan]
  • BKE39520 ([gene|19E6EF9CCA31440EAC046F8D6CA98B6A08589D58|yxeK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGATACTCCTTTTAT, downstream forward: _UP4_TATGCAAAGTAAGGAGGAAC
  • BKK39520 ([gene|19E6EF9CCA31440EAC046F8D6CA98B6A08589D58|yxeK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGATACTCCTTTTAT, downstream forward: _UP4_TATGCAAAGTAAGGAGGAAC
  • References

  • 10746760,16513748,21815947,28205250,29497411,29626092