SubtiBank SubtiBank
yppF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yppF

unknown
locus
BSU22260
pI
6.93
mw
7.13 kDa
protein length
gene length
189 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,338,582 2,338,770

    The protein

    Protein family

  • aldo/keto reductase 2 family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|19DFA1CAA52BEBBD3F31D50645E7745066E103FA|yppF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A476 (yppF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/476 NBRP B. subtilis, Japan]
  • BKE22260 ([gene|19DFA1CAA52BEBBD3F31D50645E7745066E103FA|yppF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGGTGCATCCCCTCT, downstream forward: _UP4_TAACGTCCGGCCCCCTATAA
  • BKK22260 ([gene|19DFA1CAA52BEBBD3F31D50645E7745066E103FA|yppF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGGTGCATCCCCTCT, downstream forward: _UP4_TAACGTCCGGCCCCCTATAA
  • GP2576 ([gene|19DFA1CAA52BEBBD3F31D50645E7745066E103FA|yppF]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 22383849