SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


7.13 kDa
protein length
gene length
189 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,338,582 2,338,770

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A476 (yppF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22260 ([gene|19DFA1CAA52BEBBD3F31D50645E7745066E103FA|yppF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGGTGCATCCCCTCT, downstream forward: _UP4_TAACGTCCGGCCCCCTATAA
  • BKK22260 ([gene|19DFA1CAA52BEBBD3F31D50645E7745066E103FA|yppF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGGTGCATCCCCTCT, downstream forward: _UP4_TAACGTCCGGCCCCCTATAA
  • GP2576 ([gene|19DFA1CAA52BEBBD3F31D50645E7745066E103FA|yppF]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 22383849