SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


xylan beta-1,4-xylosidase
61.17 kDa
protein length
533 aa Sequence Blast
gene length
1602 bp Sequence Blast
xylan degradation
xylan beta-1,4-xylosidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of xylan/ xylose]
  • Gene

    1,888,774 1,890,375

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (1->4)-beta-D-xylans, to remove successive D-xylose residues from the non-reducing termini (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 43 family] (according to UniProt)
  • Structure

  • [PDB|1YIF]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9973552], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|9973552], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR]: repression, [Pubmed|9973552], in [regulon|AF4395D134485290F4AA307B48494FED39E52CD7|XylR regulon]
  • regulation

  • carbon catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|9973552]
  • induction by xylose ([protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR]) [Pubmed|9973552]
  • view in new tab

    Biological materials


  • BKE17580 ([gene|19CD9BF216953613CD2E0DFB99D4C6E92AAFAE5D|xynB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGGACTCCTCCTCAG, downstream forward: _UP4_TAATTTGCACATGAAAAAGG
  • BKK17580 ([gene|19CD9BF216953613CD2E0DFB99D4C6E92AAFAE5D|xynB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGGACTCCTCCTCAG, downstream forward: _UP4_TAATTTGCACATGAAAAAGG
  • References

  • 8012596,18757537