SubtiBank SubtiBank
albC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

albC

[SW|ABC transporter ](ATP-binding protein), export of antilisterial bacteriocin (subtilosin)
locus
BSU37390
pI
5.25
mw
27.08 kDa
protein length
239 aa Sequence Blast
gene length
720 bp Sequence Blast
function
export of antilisterial bacteriocin (subtilosin)
product
[SW|ABC transporter ](ATP-binding protein)
essential
no
synonyms
ywhQ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.2|Export of antibiotic substances]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,837,840 3,838,559

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Structure

  • [PDB|4RVC] (from Geobacillus kaustophilus, 30% identity) [pubmed|25724946]
  • [SW|Localization]

  • membrane associated (via [protein|DAD8308DF72E648610D1A12BC92063E1550CB1B4|AlbD]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
    description
    [Pubmed|10572140]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A869 (ywhQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/869 NBRP B. subtilis, Japan]
  • BKE37390 ([gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATCGTGTATATCCAAAA, downstream forward: _UP4_CGGGAATTTTTCGAGGTGAT
  • BKK37390 ([gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATCGTGTATATCCAAAA, downstream forward: _UP4_CGGGAATTTTTCGAGGTGAT
  • References

  • 10809709,10092453,10572140,15743949,10809710,10572140,17720793,25724946