SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|ABC transporter ](ATP-binding protein), export of antilisterial bacteriocin (subtilosin)
27.08 kDa
protein length
239 aa Sequence Blast
gene length
720 bp Sequence Blast
export of antilisterial bacteriocin (subtilosin)
[SW|ABC transporter ](ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Export of antibiotic substances]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,837,840 3,838,559

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-238) (according to UniProt)
  • Structure

  • [PDB|4RVC] (from Geobacillus kaustophilus, 30% identity) [pubmed|25724946]
  • [SW|Localization]

  • membrane associated (via [protein|DAD8308DF72E648610D1A12BC92063E1550CB1B4|AlbD]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-A869 (ywhQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37390 ([gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATCGTGTATATCCAAAA, downstream forward: _UP4_CGGGAATTTTTCGAGGTGAT
  • BKK37390 ([gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATCGTGTATATCCAAAA, downstream forward: _UP4_CGGGAATTTTTCGAGGTGAT
  • References

  • 10809709,10092453,10572140,15743949,10809710,10572140,17720793,25724946