SubtiBank SubtiBank
nupN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nupN

lipoprotein, part of guanosine transporter
locus
BSU_31540
pI
4.82
mw
37.19 kDa
protein length
359 aa Sequence Blast
gene length
1080 bp Sequence Blast
function
uptake of guanosine
product
lipoprotein, part of guanosine transporter
essential
no
synonyms
yufN

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,239,930 3,241,009

    Phenotypes of a mutant

  • a ''[gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN] [gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]'' double mutant is unable to utilize externally provided guanosine [Pubmed|21926227]
  • The protein

    Protein family

  • BMP lipoprotein family (with [protein|4DAB7847EA3848A34432C80124464543FA3DCA0F|Med], according to UniProt)
  • Structure

  • [PDB|2FQW] (from Treponema pallidum, 45% identity) [pubmed|16418175]
  • [SW|Localization]

  • cell membrane (according to UniProt), membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN]-[gene|71546D1508EF17A208332E162CAE2C299987A569|nupO]-[gene|0BB235F189D30C9BE798560C31DA59FF0112CFD9|nupP]-[gene|7A80910F4E62BA15DE93FFC70E1908FB5CB9542D|nupQ]
    description
    [Pubmed|21926227]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21926227], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455,21699902,21926227], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455,21699902,21926227]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B553 (yufN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1552 NBRP B. subtilis, Japan]
  • BKE31540 ([gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATATAACCCCCCAGAA, downstream forward: _UP4_TAAGAATCGCAGGGATAAGG
  • BKK31540 ([gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATATAACCCCCCAGAA, downstream forward: _UP4_TAAGAATCGCAGGGATAAGG
  • References

  • 12618455,18763711,20935095,21699902,21926227,16418175