SubtiBank SubtiBank
whiA
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

whiA

WhiA family protein, involved in Z ring assembly, required for normal chromosome segregation
Locus
BSU_34750
Isoelectric point
9.48
Molecular weight
36.18 kDa
Protein length
316 aa Sequence Blast
Gene length
951 bp Sequence Blast
Function
control of Z ring asembly and chromosome segregation
Product
Cell division protein
Essential
no
Synonyms
yvcL
Outlinks
KEGGBsubCycSubtiListUniProtExpression Browser

Genomic Context

      
Loading

Categories containing this gene/protein

  • Cellular processes → Cell envelope and cell division → Cell division → Other genes
  • Information processing → Genetics → DNA condensation/ segregation
  • Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factor/ other/ based on similarity

    • Gene

    Coordinates
    3,569,573 3,570,523

    Phenotypes of a mutant

  • a whiA zapA double mutant grows poorly, and the cells are filamentous (due to a defect in Z ring assembly) PubMed
  • a whiA ezrA double mutant grows poorly, and the cells are filamentous PubMed
  • a whiA minC-minD mutant grows poorly, and the cells are filamentous PubMed
  • a whiA noc double mutant grows poorly, and the cells are filamentous PubMed
  • a whiA parB double mutant is not viable, this can be suppressed by inactivation of yneA PubMed
  • a whiA yabA double mutant is not viable PubMed
  • the defects of the whiA zapA double mutant can be suppressed by inactivation of either gtaB, pgcA, or ugtP PubMed
  • highly sensitive for DNA damaging agents PubMed

    • The protein

    Protein family

  • WhiA family (single member, according to UniProt) PubMed

    • Domains

  • suggested HTH domain at the N terminus PubMed

    • Structure

  • 3HYI (Crystal structure of full-length DUF199/WhiA from Thermotoga maritima)
  • 3HYJ (Crystal structure of the N-terminal LAGLIDADG domain of DUF199/WhiA)

    • Localization

  • localizes to the nucleoid PubMed

    • Expression and Regulation

    Operons

    Genes
    nahA-yvcJ-glmR-whiA-crh-yvcN
    Description
    PubMed

    Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

    • Regulatory mechanism

  • CcpA: repression, in CcpA regulon

    • Regulation

  • constitutive expression at both protein and RNA levels PubMed

    • Additional information

  • A ncRNA is predicted between 'yvcI' and 'trxB' PubMed
    • view in new tab

    Biological materials

    Mutant

  • MGNA-B639 (yvcL::erm), available at the NBRP B. subtilis, Japan
  • GP231 (amyE::PrpsJ-lacZ, whiA::cat) available in Jörg Stülke's lab; plasmid pGP1468 was used to disrupt the gene.
  • BKE34750 (ΔwhiA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAGCCACCTCATTTCA, downstream forward: _UP4_TAACCGTAAAGAAAAGGGGA
  • BKK34750 (ΔwhiA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAGCCACCTCATTTCA, downstream forward: _UP4_TAACCGTAAAGAAAAGGGGA

    • Expression vectors

  • pGP1469 for expression in B. subtilis (in pGP382, with C-terminal STREP-TAG), available in Jörg Stülke's lab
  • pGP2429 (N-terminal Strep-Tag, purification from E. coli and/or B. subtilis, in pDG148), for SPINE, available in Jörg Stülke's lab
  • pGP2430 (C-terminal Strep-Tag, purification from E. coli and/or B. subtilis, in pDG148), for SPINE, available in Jörg Stülke's lab

    • Two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's and Boris Görke's labs

    • FLAG-tag construct

  • GP782 (spc, based on pGP1331), available in Jörg Stülke's lab

    • Antibody

  • available in Leendert Hamoen's lab PubMed

    • References

    Loading