SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


pectate lyase
37.95 kDa
protein length
345 aa Sequence Blast
gene length
1038 bp Sequence Blast
degradation of polygalacturonic acid
pectate lyase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,034,745 2,035,782

    The protein

    Catalyzed reaction/ biological activity

  • Eliminative cleavage of (1->4)-alpha-D-galacturonan methyl ester to give oligosaccharides with 4-deoxy-6-O-methyl-alpha-D-galact-4-enuronosyl groups at their non-reducing ends (according to UniProt)
  • Protein family

  • [SW|lyase 1 family] (according to UniProt)
  • Structure

  • [PDB|3VMV] (from Bacillus sp. N165, 29% identity) [pubmed|22414692]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Biological materials


  • BKE18650 ([gene|19854503A5A0A19E72C8E1BEC65EECC243E96F79|pelB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAATATGCTTCCTTT, downstream forward: _UP4_TGATATAAAAGAGGCCCTGC
  • BKK18650 ([gene|19854503A5A0A19E72C8E1BEC65EECC243E96F79|pelB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAATATGCTTCCTTT, downstream forward: _UP4_TGATATAAAAGAGGCCCTGC
  • References

  • 18957862,22414692