SubtiBank SubtiBank
ywlD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywlD

unknown
locus
BSU_36940
pI
8.61
mw
19.51 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipc-30d

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,792,333 3,792,890

    The protein

    Protein family

  • MntP (TC 9.B.29) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|19829F6D993188BE854F0F61CB93777AD04CF754|ywlD]-[gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]-[gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]-[gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A200 (ywlD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/200 NBRP B. subtilis, Japan]
  • BKE36940 ([gene|19829F6D993188BE854F0F61CB93777AD04CF754|ywlD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATAAATAACCCCCTT, downstream forward: _UP4_TAATATACCAATAAAAGAAA
  • BKK36940 ([gene|19829F6D993188BE854F0F61CB93777AD04CF754|ywlD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATAAATAACCCCCTT, downstream forward: _UP4_TAATATACCAATAAAAGAAA