SubtiBank SubtiBank
queC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

queC

synthesis of the modified ribonucleotide queuosine
locus
BSU_13720
pI
5.15
mw
24.38 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast
function
tRNA modification
product
unknown
essential
no
synonyms
ykvJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    1,439,448 1,440,107

    The protein

    Catalyzed reaction/ biological activity

  • 7-carboxy-7-deazaguanine + ATP + NH4+ --> 7-cyano-7-deazaguanine + ADP + H+ + H2O + phosphate (according to UniProt)
  • Protein family

  • queC family (single member, according to UniProt)
  • Structure

  • [PDB|3BL5] [Pubmed|18491386]
  • Expression and Regulation

    Operons

    genes
    [gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]-[gene|BA6DD5C9AB9BFF9759E9ECC46CE3DF4EB7E67F52|queD]-[gene|F5189CAA5EF43FCF95E593E095F84B3BE486B347|queE]-[gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]
    description
    [Pubmed|14660578]

    regulatory mechanism

  • [regulon|preQ1 riboswitch|preQ1 riboswitch]: antitermination, in the absence of queuosine [Pubmed|19285444], in [regulon|preQ1 riboswitch|preQ1 riboswitch]
  • regulation

  • repressed in the presence of queuosine ([SW|preQ1 riboswitch]) [Pubmed|19285444]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A789 (ykvJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/789 NBRP B. subtilis, Japan]
  • BKE13720 ([gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCCTCTCCTTCTCC, downstream forward: _UP4_GAATATATGGTGATGAAAGG
  • BKK13720 ([gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCCTCTCCTTCTCC, downstream forward: _UP4_GAATATATGGTGATGAAAGG
  • References

  • 18491386,14660578,17384645,19285444,19354300,24003028,21410253,21375305,24663240