SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


similar to ribosomal-protein-alanine N-acetyltransferase
20.22 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation/ other/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein acetylase/ deacetylase/ based on similarity]
  • Gene

    1,883,166 1,883,678

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|YoaA]
  • [protein|F92B7EC7A00BF295666D68613932D239F92C7347|YkkB]:
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 8-167) (according to UniProt)
  • Structure

  • [PDB|3FBU] (from B. anthracis, 82% identity)
  • Biological materials


  • MGNA-B382 (ynaD::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1247 (''ynaD''::''spec''), available in [SW|Jörg Stülke]'s lab
  • GP1255 (''[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]''::''kan'' ''[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]''::''cat'' ''[gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]''::''spec'' ''[gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BKE17520 ([gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAGCAACTCCCCTCT, downstream forward: _UP4_TGAACTTTATTGAGTGCGGC
  • BKK17520 ([gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAGCAACTCCCCTCT, downstream forward: _UP4_TGAACTTTATTGAGTGCGGC