SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative SPBc2 prophage-derived 5'(3')-deoxyribonucleotidase
20.27 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,172,932 2,173,450

    The protein

    Protein family

  • 5'(3')-deoxyribonucleotidase family (with [protein|098F3D9EB9A30575E2393F7F335E4ADD8D028C2A|YqfW], according to UniProt)
  • Structure

  • [PDB|3BWV] (from Staphylococcus epidermidis, 40% identity)
  • Biological materials


  • BKE20270 ([gene|18F8A8EBABD9846966A8DEFD9D4E3F2404828E92|yorS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTACTTTTTTCATAAATT, downstream forward: _UP4_TAAAATATCTCATTTATCCA
  • BKK20270 ([gene|18F8A8EBABD9846966A8DEFD9D4E3F2404828E92|yorS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTACTTTTTTCATAAATT, downstream forward: _UP4_TAAAATATCTCATTTATCCA