SubtiBank SubtiBank
ydjM
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydjM

member of the [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
locus
BSU_06250
pI
10.57
mw
13.04 kDa
protein length
123 aa Sequence Blast
gene length
372 bp Sequence Blast
function
may be involved in cell wall metabolism ([regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon])
product
unknown
essential
no
synonyms
yzvA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    679,390 679,761

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|20709850]
  • Expression and Regulation

    Operons

    genes
    [gene|18ED48E99D87748B2EBD6001EFDF1D3D91535ABF|ydjM]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|20059685], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • activated by [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] [Pubmed|17581128]
  • additional information

  • the terminator is [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA]-dependent [ http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    genes
    [gene|18ED48E99D87748B2EBD6001EFDF1D3D91535ABF|ydjM]-[gene|6B93DA610D4D86A5D4E53190999FB0E4E10AE8E5|ydjN]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [pubmed|17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [pubmed|20059685], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • activated by [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] [Pubmed|17581128]
  • additional information

  • the terminator is [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA]-dependent [ http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C220 (ydjM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2218 NBRP B. subtilis, Japan]
  • BKE06250 ([gene|18ED48E99D87748B2EBD6001EFDF1D3D91535ABF|ydjM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGTCCCCCTGTTTGT, downstream forward: _UP4_TAATGTACATATATAATCTG
  • BKK06250 ([gene|18ED48E99D87748B2EBD6001EFDF1D3D91535ABF|ydjM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGTCCCCCTGTTTGT, downstream forward: _UP4_TAATGTACATATATAATCTG
  • References

  • 17581128,20059685,20709850,23199363