SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to multidrug-efflux transporter
11.29 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
subunit of unidentified multidrug transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Multidrug exporters]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.3|Chaperone/ protein folding/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,541,823 3,542,143

    The protein

    Protein family

  • paired small multidrug resistance protein family ([SW|PSMR family]) [Pubmed|17942072]
  • [SW|drug/metabolite transporter (DMT) superfamily] (according to UniProt)
  • [SW|Small multidrug resistance (SMR) (TC 2.A.7.1) family] (according to UniProt)
  • Structure

  • [PDB|3B5D] (E. coli EmrE, 33% identity) [pubmed|18024586]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B618 (yvdR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34500 ([gene|18CBED273AD7787971073117DFA0B89BDF149B25|yvdR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTTCACCTCCCGG, downstream forward: _UP4_TAAAATCAAGGCATATACAG
  • BKK34500 ([gene|18CBED273AD7787971073117DFA0B89BDF149B25|yvdR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTTCACCTCCCGG, downstream forward: _UP4_TAAAATCAAGGCATATACAG
  • References

    Research papers

  • 22978536,18024586