SubtiBank SubtiBank
yvdR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvdR

similar to multidrug-efflux transporter
locus
BSU_34500
pI
9.06
mw
11.29 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
function
unknown
product
subunit of unidentified multidrug transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.14|Multidrug exporters]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.3|Chaperone/ protein folding/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,541,823 3,542,143

    The protein

    Protein family

  • paired small multidrug resistance protein family ([SW|PSMR family]) [Pubmed|17942072]
  • [SW|drug/metabolite transporter (DMT) superfamily] (according to UniProt)
  • [SW|Small multidrug resistance (SMR) (TC 2.A.7.1) family] (according to UniProt)
  • Structure

  • [PDB|3B5D] (E. coli EmrE, 33% identity) [pubmed|18024586]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8417C205E756C27D25BCEA9394DEB0968B5F4F7B|yvdT]-[gene|FDE9E1E86BA06B4CE782CBA32F113D302A0B2231|yvdS]-[gene|18CBED273AD7787971073117DFA0B89BDF149B25|yvdR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B618 (yvdR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1617 NBRP B. subtilis, Japan]
  • BKE34500 ([gene|18CBED273AD7787971073117DFA0B89BDF149B25|yvdR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTTCACCTCCCGG, downstream forward: _UP4_TAAAATCAAGGCATATACAG
  • BKK34500 ([gene|18CBED273AD7787971073117DFA0B89BDF149B25|yvdR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTTCACCTCCCGG, downstream forward: _UP4_TAAAATCAAGGCATATACAG
  • References

    Research papers

  • 22978536,18024586