SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


23.05 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,765,469 3,766,110

    The protein


  • [PDB|3EW7] (from Listeria monocytogenes, 50% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A202 (ywnB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36620 ([gene|188A260FF9BABD22CF4A102138D5D8AA40F00E9E|ywnB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATTTCCTCCTTA, downstream forward: _UP4_TAATAAAAAACCCGGAGCCA
  • BKK36620 ([gene|188A260FF9BABD22CF4A102138D5D8AA40F00E9E|ywnB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATTTCCTCCTTA, downstream forward: _UP4_TAATAAAAAACCCGGAGCCA
  • References

  • 9353933