SubtiBank SubtiBank
ywnB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywnB

unknown
locus
BSU_36620
pI
5.16
mw
23.05 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,765,469 3,766,110

    The protein

    Structure

  • [PDB|3EW7] (from Listeria monocytogenes, 50% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|C72A3F6EB0163A711D62A23EA47ED237F5D91BB4|ywnA]-[gene|188A260FF9BABD22CF4A102138D5D8AA40F00E9E|ywnB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A202 (ywnB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/202 NBRP B. subtilis, Japan]
  • BKE36620 ([gene|188A260FF9BABD22CF4A102138D5D8AA40F00E9E|ywnB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATTTCCTCCTTA, downstream forward: _UP4_TAATAAAAAACCCGGAGCCA
  • BKK36620 ([gene|188A260FF9BABD22CF4A102138D5D8AA40F00E9E|ywnB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATTTCCTCCTTA, downstream forward: _UP4_TAATAAAAAACCCGGAGCCA
  • References

  • 9353933