SubtiBank SubtiBank
fra
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fra

frataxin-like protein, required for the biosynthesis of iron-sulfur clusters, intracellular carrier to provide iron for the ferrochelatase HemH
locus
BSU_05750
pI
5.38
mw
14.28 kDa
protein length
123 aa Sequence Blast
gene length
372 bp Sequence Blast
function
intracellular iron channeling, biosynthesis of iron-sulfur clusters
product
frataxin-like protein
essential
no
synonyms
ydhG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.3|Biosynthesis of iron-sulfur clusters]
  • Gene

    Coordinates
    621,847 622,218

    Phenotypes of a mutant

  • severe growth phenotype associated with a broadly disturbed iron homeostasis [Pubmed|21744456]
  • The protein

    Catalyzed reaction/ biological activity

  • transfers iron onto the B. subtilis SUF system ([protein|C0C30D2A6D3DF7A66063010044D370BD36D27DBF|SufU]-[protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS]) for iron-sulfur cluster biosynthesis [Pubmed|21744456]
  • [SW|Cofactors]

  • Fe(2+) is bound with high affinity [Pubmed|20087498]
  • Structure

  • [PDB|2OC6]
  • Expression and Regulation

    Operons

    genes
    [gene|188833286AD73DF7730954D47BD676D8137679E9|fra]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C182 (ydhG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2180 NBRP B. subtilis, Japan]
  • available in [SW|Mohamed Marahiel]'s lab
  • BKE05750 ([gene|188833286AD73DF7730954D47BD676D8137679E9|fra]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTTCCCTCCTAAAA, downstream forward: _UP4_TGAAGAAAAAGGCATAACAT
  • BKK05750 ([gene|188833286AD73DF7730954D47BD676D8137679E9|fra]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTTCCCTCCTAAAA, downstream forward: _UP4_TGAAGAAAAAGGCATAACAT
  • References

  • 20087498,21744456,25826316,27382962