SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


frataxin-like protein, required for the biosynthesis of iron-sulfur clusters, intracellular carrier to provide iron for the ferrochelatase HemH
14.28 kDa
protein length
123 aa Sequence Blast
gene length
372 bp Sequence Blast
intracellular iron channeling, biosynthesis of iron-sulfur clusters
frataxin-like protein

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Biosynthesis of iron-sulfur clusters]
  • Gene

    621,847 622,218

    Phenotypes of a mutant

  • severe growth phenotype associated with a broadly disturbed iron homeostasis [Pubmed|21744456]
  • The protein

    Catalyzed reaction/ biological activity

  • transfers iron onto the B. subtilis SUF system ([protein|C0C30D2A6D3DF7A66063010044D370BD36D27DBF|SufU]-[protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS]) for iron-sulfur cluster biosynthesis [Pubmed|21744456]
  • [SW|Cofactors]

  • Fe(2+) is bound with high affinity [Pubmed|20087498]
  • Structure

  • [PDB|2OC6]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C182 (ydhG::erm), available at the [ NBRP B. subtilis, Japan]
  • available in [SW|Mohamed Marahiel]'s lab
  • BKE05750 ([gene|188833286AD73DF7730954D47BD676D8137679E9|fra]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTTCCCTCCTAAAA, downstream forward: _UP4_TGAAGAAAAAGGCATAACAT
  • BKK05750 ([gene|188833286AD73DF7730954D47BD676D8137679E9|fra]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTTCCCTCCTAAAA, downstream forward: _UP4_TGAAGAAAAAGGCATAACAT
  • References

  • 20087498,21744456,25826316,27382962