SubtiBank SubtiBank
ycnB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycnB

c-di-AMP exporter
locus
BSU_03840
pI
10.83
mw
50.63 kDa
protein length
472 aa Sequence Blast
gene length
1419 bp Sequence Blast
function
secretion of cyclic di-AMP
product
c-di-AMP exporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    436,036 437,454

    The protein

    Catalyzed reaction/ biological activity

  • secretion of cyclic di-AMP [pubmed|29588402]
  • Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|EmrB family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|23483430AE0381406EF2349A18CFAE1F14F9B180|LmrB], [protein|93159DC7D5C42CFA54F66F232D73F38957243AB7|YhcA]
  • [SW|Localization]

  • cell membrane (according to UniProt), membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|C993D176CE1B93A74D34B45DFFE30295245E2BD2|ycnC]-[gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C012 (ycnB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2010 NBRP B. subtilis, Japan]
  • GP1702 (''[gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • GP1703 (''[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]''::''aphA3'' ''[gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE03840 ([gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAATACATATCCCTTCT, downstream forward: _UP4_TGATTAACAAAAAAAGAGCC
  • BKK03840 ([gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAATACATATCCCTTCT, downstream forward: _UP4_TGATTAACAAAAAAAGAGCC
  • References

  • 18763711,22383849,29588402