SubtiBank SubtiBank
bshA

bshA

L-malic acid glycosyltransferase, involved in bacillithiol synthesis
locus
BSU_22460
pI
6.15
mw
41.82 kDa
protein length
377 aa Sequence Blast
gene length
1134 bp Sequence Blast
function
biosynthesis of bacillithiol
product
L-malic acid glycosyltransferase
essential
no
synonyms
jojH,ypjH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.2|Biosynthesis of bacillithiol]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,357,078 2,358,211

    Phenotypes of a mutant

  • impaired growth in minimal medium, reduced activity of enzymes containing FeS cluster [Pubmed|25988368]
  • sensitivity to superoxide (paraquate) stress [Pubmed|25988368]
  • The protein

    Catalyzed reaction/ biological activity

  • UDP-GlcNAc L-malate = GlcNAc(12)L-malate UDP [Pubmed|20308541]; also uses D-malate as a substrate, but with much lower affinity [Pubmed|20308541]
  • (S)-malate + UDP-N-acetyl-α-D-glucosamine --> (S)-malyl N-acetyl-α-D-glucosaminide + H+ + UDP (according to UniProt)
  • Protein family

  • [SW|Glycosyltransferase 1 family] (according to UniProt)
  • [SW|Glycosyltransferase 4 subfamily] (according to UniProt)
  • Effectors of protein activity

  • subject to feedback inhibition by bacillithiol [Pubmed|22569254]
  • Structure

  • [PDB|5D00] [Pubmed|27454321]
  • Expression and Regulation

    Operons

    genes
    [gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]-[gene|5AB90032031653A913E15B26B3E1AE246E95AABF|dapB]-[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]-[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]-[gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]-[gene|4C4FA59FF5D100E941EF470C0C54E85681ADC74F|cca]-[gene|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA]
    description
    [Pubmed|20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A410 (ypjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/410 NBRP B. subtilis, Japan]
  • ''bshA::mls'' available in [SW|John_Helmann] lab
  • GP88 (''bshA''::''pX2''(''cat'')), available in [SW|Jörg Stülke]'s lab
  • BKE22460 ([gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATTGTTCGCCCCCAAG, downstream forward: _UP4_GATTTAGCAGAACCGGAGTG
  • BKK22460 ([gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATTGTTCGCCCCCAAG, downstream forward: _UP4_GATTTAGCAGAACCGGAGTG
  • References

    Reviews

  • 28117687
  • Original Publications

  • 20308541,19578333,22569254,20799687,23894131,25988368,27454321