SubtiBank SubtiBank
yxnA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxnA

general stress protein, similar to ketoacyl reductase, survival of ethanol stress
locus
BSU_40000
pI
9.31
mw
39.20 kDa
protein length
356 aa Sequence Blast
gene length
1071 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    4,108,058 4,109,128

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0927C7D45721F47F5ED2646CAAC324A308FD7724|YqjQ]:
  • Structure

  • [PDB|4NBU] ([protein|439B468A13137000FB42E9389391CB4986FFED84|FabG] from Bacillus sp., corresponds to aa 26 ... 255 of YxnA, 32% identity) [pubmed|24212572]
  • Expression and Regulation

    Operons

    genes
    [gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B762 (yxnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1761 NBRP B. subtilis, Japan]
  • BKE40000 ([gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAGATCCCTCCTAG, downstream forward: _UP4_TAATCTCTGACCATAAGAAA
  • BKK40000 ([gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAGATCCCTCCTAG, downstream forward: _UP4_TAATCTCTGACCATAAGAAA
  • References

  • 15805528,10746760,24212572