SubtiBank SubtiBank
ypeP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypeP

similar to RNase HI
locus
BSU21970
pI
5.24
mw
13.58 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.5|RNase/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    2,308,967 2,309,647

    Expression and Regulation

    Operons

    genes
    [gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]-[gene|A4B5C9A4BA04B0501766DADF19A49B67F92857C3|ypeQ]
    description
    [pubmed|22383849]
    regulation
    expressed during [SW|sporulation] [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A893 (ypeP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/893 NBRP B. subtilis, Japan]
  • BP443 (''ypeP::tet'') available in [SW|Fabian Commichau]'s lab
  • BKE21970 ([gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATCACCTTACCAT, downstream forward: _UP4_TTAGACCGTAACGGAGATGA
  • BKK21970 ([gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATCACCTTACCAT, downstream forward: _UP4_TTAGACCGTAACGGAGATGA
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], based on [SW|pGP380], expression from plasmid: pBP501 (E. coli amp & B. subtilis E/L) , available in [SW|Fabian Commichau]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • References

    Research papers

  • 29084857