SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to RNase HI
13.58 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.5|RNase/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • Gene

    2,308,967 2,309,647

    The protein


  • RNase H domain (aa 71-207) (according to UniProt)
  • Expression and Regulation


    expressed during [SW|sporulation] [Pubmed|22383849]
    view in new tab

    Biological materials


  • MGNA-A893 (ypeP::erm), available at the [ NBRP B. subtilis, Japan]
  • BP443 (''ypeP::tet'') available in [SW|Fabian Commichau]'s lab
  • BKE21970 ([gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATCACCTTACCAT, downstream forward: _UP4_TTAGACCGTAACGGAGATGA
  • BKK21970 ([gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATCACCTTACCAT, downstream forward: _UP4_TTAGACCGTAACGGAGATGA
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], based on [SW|pGP380], expression from plasmid: pBP501 (E. coli amp & B. subtilis E/L) , available in [SW|Fabian Commichau]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • References

    Research papers

  • 29084857