SubtiBank SubtiBank
copZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

copZ

copper transport protein, metallochaperone
locus
BSU33510
pI
4.16
mw
7.20 kDa
protein length
gene length
210 bp Sequence Blast
function
resistance to copper
product
copper transport protein, metallochaperone
essential
no
synonyms
yvgY

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.1|Copper]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    3,443,613 3,443,822

    The protein

    Catalyzed reaction/ biological activity

  • transfers Cu(I) to [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|CopA] [Pubmed|28078344]
  • [SW|Cofactors]

  • carries a tetranuclear Cu(I) cluster (as [Cu4(S-Cys)4(N-His)2] cluster) [Pubmed|19746989]
  • Structure

  • [PDB|2QIF]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6977F18870004AD236539D9409255815E6BE9241|csoR]-[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
    description
    [Pubmed|12779235]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12779235], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6977F18870004AD236539D9409255815E6BE9241|CsoR]: repression, [Pubmed|18048925], in [regulon|6977F18870004AD236539D9409255815E6BE9241|CsoR regulon]
  • regulation

  • induced by copper ([protein|search|CsoR]) [Pubmed|18048925,12779235]
  • view in new tab

    Biological materials

    Mutant

  • BKE33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT, downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
  • BKK33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT, downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 19824702,10742187
  • Original publications

  • 18361527,11922674,12590580,14663075,12779235,12644235,18048925,19170606,14514665,14711369,15212800,19170606,19746989,19751213,18419582,22370900,12238948,11980486,27197762,28078344