SubtiBank SubtiBank
copZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

copZ

copper transport protein, metallochaperone
locus
BSU_33510
pI
4.16
mw
7.20 kDa
protein length
gene length
210 bp Sequence Blast
function
resistance to copper
product
copper transport protein, metallochaperone
essential
no
synonyms
yvgY

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.1|Copper]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    3,443,613 3,443,822

    The protein

    Catalyzed reaction/ biological activity

  • transfers Cu(I) to [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|CopA] [Pubmed|28078344]
  • [SW|Domains]

  • HMA domain (aa 3-69) (according to UniProt)
  • [SW|Cofactors]

  • carries a tetranuclear Cu(I) cluster (as [Cu4(S-Cys)4(N-His)2] cluster) [Pubmed|19746989]
  • Structure

  • [PDB|2QIF]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6977F18870004AD236539D9409255815E6BE9241|csoR]-[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
    description
    [Pubmed|12779235]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12779235], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6977F18870004AD236539D9409255815E6BE9241|CsoR]: repression, [Pubmed|18048925], in [regulon|6977F18870004AD236539D9409255815E6BE9241|CsoR regulon]
  • regulation

  • induced by copper ([protein|search|CsoR]) [Pubmed|18048925,12779235]
  • view in new tab

    Biological materials

    Mutant

  • BKE33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT, downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
  • BKK33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT, downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 19824702,10742187
  • Original publications

  • 18361527,11922674,12590580,14663075,12779235,12644235,18048925,19170606,14514665,14711369,15212800,19170606,19746989,19751213,18419582,22370900,12238948,11980486,27197762,28078344