SubtiBank SubtiBank
copZ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

copZ

copper transport protein, metallochaperone
locus
BSU_33510
pI
4.16
mw
7.20 kDa
protein length
gene length
210 bp Sequence Blast
function
resistance to copper
product
copper transport protein, metallochaperone
essential
no
synonyms
yvgY

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.1|Copper]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    3,443,613 3,443,822

    The protein

    Catalyzed reaction/ biological activity

  • transfers Cu(I) to [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|CopA] [Pubmed|28078344]
  • [SW|Domains]

  • HMA domain (aa 3-69) (according to UniProt)
  • [SW|Cofactors]

  • carries a tetranuclear Cu(I) cluster (as [Cu4(S-Cys)4(N-His)2] cluster) [Pubmed|19746989]
  • Structure

  • [PDB|2QIF]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6977F18870004AD236539D9409255815E6BE9241|csoR]-[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
    description
    [Pubmed|12779235]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12779235], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6977F18870004AD236539D9409255815E6BE9241|CsoR]: repression, [Pubmed|18048925], in [regulon|6977F18870004AD236539D9409255815E6BE9241|CsoR regulon]
  • regulation

  • induced by copper ([protein|search|CsoR]) [Pubmed|18048925,12779235]
  • view in new tab

    Biological materials

    Mutant

  • BKE33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT, downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
  • BKK33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT, downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 19824702,10742187
  • Original publications

  • 18361527,11922674,12590580,14663075,12779235,12644235,18048925,19170606,14514665,14711369,15212800,19170606,19746989,19751213,18419582,22370900,12238948,11980486,27197762,28078344