SubtiBank SubtiBank
hisG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hisG

ATP phosphoribosyltransferase
locus
BSU34920
pI
4.53
mw
23.47 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
biosynthesis of histidine
product
ATP phosphoribosyltransferase
essential
no
ec
2.4.2.17
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.14|Biosynthesis/ acquisition of histidine]
  • Gene

    Coordinates
    3,587,551 3,588,192

    The protein

    Catalyzed reaction/ biological activity

  • 1-(5-phospho-D-ribosyl)-ATP + diphosphate = ATP + 5-phospho-alpha-D-ribose 1-diphosphate (according to Swiss-Prot)
  • Protein family

  • Short subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|2VD2]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|E8FD92F48BE16F87D7481262F4E49003A78DE78F|hisZ]-[gene|183C8B4F28E601D670B3D997D333AF2B5C4A4759|hisG]-[gene|03274B80B2DFE0A2939981B0E0CB8C34A9B0B102|hisD]-[gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]-[gene|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH]-[gene|148F0C7983250F50676D234DB713E532AA55DDBF|hisA]-[gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]-[gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE34920 ([gene|183C8B4F28E601D670B3D997D333AF2B5C4A4759|hisG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTGGCATCGCCATTGTGA, downstream forward: _UP4_GTTGTGGAAGGAGAGACGGC
  • BKK34920 ([gene|183C8B4F28E601D670B3D997D333AF2B5C4A4759|hisG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTGGCATCGCCATTGTGA, downstream forward: _UP4_GTTGTGGAAGGAGAGACGGC
  • References

  • 12107147,28516784