SubtiBank SubtiBank
iolQ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

iolQ

transcriptional repressor of [gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX] expression, transcriptional activator involved in the degradation of glutamine phosphoribosylpyrophosphate amidotransferase
locus
BSU_10840
pI
5.78
mw
36.44 kDa
protein length
337 aa Sequence Blast
gene length
1014 bp Sequence Blast
function
control of scyllo-inositol utilization
product
transcription factor ([SW|LacI family])
essential
no
synonyms
degA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,163,148 1,164,161

    The protein

    Catalyzed reaction/ biological activity

  • binds to [gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX] promoter region [pubmed|28693424]
  • [SW|Domains]

  • [SW|HTH lacI-type domain] (aa 1-57) (according to UniProt)
  • Structure

  • [PDB|2HSG] ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA], 35% identity) [pubmed|17500051]
  • Expression and Regulation

    Operons

    genes
    [gene|5B173B400D0B4C150E94A98D35E27B0B4358489B|yisR]-[gene|17F5188958A415D8D09439E02E1D1E0661B5C760|iolQ]
    description
    [pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE10840 ([gene|17F5188958A415D8D09439E02E1D1E0661B5C760|iolQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTCATCCCTCGTC, downstream forward: _UP4_TGAGCCCGCTAATGAGCGGG
  • BKK10840 ([gene|17F5188958A415D8D09439E02E1D1E0661B5C760|iolQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTCATCCCTCGTC, downstream forward: _UP4_TGAGCCCGCTAATGAGCGGG
  • References

  • 8407808,12884008,28693424