SubtiBank SubtiBank
yueH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yueH

unknown
locus
BSU_31780
pI
6.35
mw
9.44 kDa
protein length
gene length
249 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,262,009 3,262,257

    Expression and Regulation

    Operons

    genes
    [gene|17F2619E74A1604E86ED94E1BEE683D49E437A6C|yueH]-[gene|3918D82756A64E86E96A21ACEB34B0CF992D662D|yueI]-[gene|26430DCCEC263E7D03A3BBA4E7D636A250C3208B|pncA]-[gene|7CA7ADDBDDE46B0E6522704FD19C0BCF6FA9E058|pncB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A642 (yueH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/642 NBRP B. subtilis, Japan]
  • BKE31780 ([gene|17F2619E74A1604E86ED94E1BEE683D49E437A6C|yueH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATGACCTCTCTATT, downstream forward: _UP4_TAAACGGCGCTTGAAAGTTT
  • BKK31780 ([gene|17F2619E74A1604E86ED94E1BEE683D49E437A6C|yueH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATGACCTCTCTATT, downstream forward: _UP4_TAAACGGCGCTTGAAAGTTT