SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cation/H+ antiporter
75.05 kDa
protein length
670 aa Sequence Blast
gene length
2013 bp Sequence Blast
monovalent cation export
cation/H+ antiporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Sodium uptake/ export]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,428,331 3,430,343

    The protein

    Catalyzed reaction/ biological activity

  • export of Na+, K+, Li+, Rb+
  • Protein family

  • monovalent cation:proton antiporter 1 (CPA1) transporter (TC 2.A.36) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation




  • constitutive, expression increases in the presence of Na+ and K+ [Pubmed|16021482]
  • view in new tab

    Biological materials


  • MGNA-A455 (yvgP::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2226 (''[gene|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK]''::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • BKE33420 ([gene|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCATGACCTCCTTCG, downstream forward: _UP4_TAAATGCAGAAAAAAAGCTG
  • BKK33420 ([gene|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCATGACCTCCTTCG, downstream forward: _UP4_TAAATGCAGAAAAAAAGCTG
  • FLAG-tag construct

  • GP2436 ''nhaK-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 27935846
  • Original publications

  • 16021482,28420751