SubtiBank SubtiBank
acuA

acuA

protein acetylase for the control of [protein|search|AcsA ]activity
locus
BSU_29690
pI
5.03
mw
24.18 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
function
control of [protein|search|AcsA ]activity
product
Gcn5-related N-acetyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.5|Protein acetylases/ deacetylases]
  • Gene

    Coordinates
    3,040,092 3,040,724

    The protein

    Catalyzed reaction/ biological activity

  • acetylates (and thereby inactivates) [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA] on Lys-549 [Pubmed|18487328] [Pubmed|19136592]
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Gcn5-relatedN-acetyltransferase [Pubmed|18487328]
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 20-161) (according to UniProt)
  • Structure

  • [PDB|2Q04] (from Exiguobacterium sibiricum, 59% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]-[gene|FC9981CFB9D7EB8ACDA3032EC2F0538988F277AA|acuB]-[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]
    description
    [Pubmed|7934817]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7913927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7913927], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|7913927,12850135]
  • additional information

  • the mRNA is quite stable (half-life 5 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • GP1211 (''acuA''::''kan''), available in [SW|Jörg Stülke]'s lab
  • GP1255 (''[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]''::''kan'' ''[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]''::''cat'' ''[gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]''::''spec'' ''[gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BKE29690 ([gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAATTCACCGTCCCATC, downstream forward: _UP4_TAACTGACACTGACAAAGGG
  • BKK29690 ([gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAATTCACCGTCCCATC, downstream forward: _UP4_TAACTGACACTGACAAAGGG
  • References

  • 7913927,22900538,16855235,7934817,19136592,18487328,12850135,26098117,29093482,12884008,30265683