SubtiBank SubtiBank
yrhC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrhC

unknown
locus
BSU_27240
pI
7.89
mw
8.50 kDa
protein length
gene length
231 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,784,688 2,784,918

    Expression and Regulation

    Operons

    genes
    [gene|992A24CF9492965BF0E9EEFBB6F0A06871275068|yrrT]-[gene|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|mtnN]-[gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA]-[gene|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|mccB]-[gene|177EFFDCA6E3C3BB840EED13D9F2D71F99B833B6|yrhC]
    description
    [Pubmed|17056751]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660,16885442], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A847 (yrhC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/847 NBRP B. subtilis, Japan]
  • BKE27240 ([gene|177EFFDCA6E3C3BB840EED13D9F2D71F99B833B6|yrhC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAATCACCTGCCAGA, downstream forward: _UP4_TAAAAAAACAGCCATCATCA
  • BKK27240 ([gene|177EFFDCA6E3C3BB840EED13D9F2D71F99B833B6|yrhC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAATCACCTGCCAGA, downstream forward: _UP4_TAAAAAAACAGCCATCATCA
  • References

  • 17056751,16513748,16885442,12642660