SubtiBank SubtiBank
yufS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yufS

unknown
locus
BSU_31590
pI
6.07
mw
7.94 kDa
protein length
gene length
216 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,246,152 3,246,367

    The protein

    [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1729DD4CCBA147D433C8027D08447A14A20FA710|yufS]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A637 (yufS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/637 NBRP B. subtilis, Japan]
  • BKE31590 ([gene|1729DD4CCBA147D433C8027D08447A14A20FA710|yufS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGACCAGCTCCTTTCC, downstream forward: _UP4_TAAAAAAAGAGTTCCGCATA
  • BKK31590 ([gene|1729DD4CCBA147D433C8027D08447A14A20FA710|yufS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGACCAGCTCCTTTCC, downstream forward: _UP4_TAAAAAAAGAGTTCCGCATA
  • References

    Research papers

  • 30355672