SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


7.94 kDa
protein length
gene length
216 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,246,152 3,246,367

    The protein


  • membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • MGNA-A637 (yufS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31590 ([gene|1729DD4CCBA147D433C8027D08447A14A20FA710|yufS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGACCAGCTCCTTTCC, downstream forward: _UP4_TAAAAAAAGAGTTCCGCATA
  • BKK31590 ([gene|1729DD4CCBA147D433C8027D08447A14A20FA710|yufS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGACCAGCTCCTTTCC, downstream forward: _UP4_TAAAAAAAGAGTTCCGCATA
  • References

    Research papers

  • 30355672