SubtiBank SubtiBank
yacP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yacP

[SW|ribosome]-associated A site endoribonuclease
locus
BSU_00970
pI
7.28
mw
19.53 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
function
ribosome-dependent mRNA decay
product
A site endoribonuclease
essential
no
synonyms
rae1

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • Gene

    Coordinates
    116,025 116,537

    The protein

    [SW|Domains]

  • N-terminal NYN domain [pubmed|28363943,17114934]
  • C-terminal flexible RNA-binding domain [pubmed|28363943]
  • Structure

  • [PDB|5MQ8] [pubmed|28363943]
  • Expression and Regulation

    Operons

    genes
    [gene|132E91DB8C81CD8C4F5160B2C068B74DA10AE224|gltX]-[gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE]-[gene|E5826A99769E2FE45959A9D623D6467A8DDDEB81|cysS]-[gene|031FDF8443A8A4D5B042B7591EBE2E6C74F07702|mrnC]-[gene|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|yacO]-[gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]
    description
    [Pubmed|7510287]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7510287], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: transcription antitermination, overlaps a transcription terminator upstream of [gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE], in [regulon|T-box|T-box]
  • regulation

  • expression transiently increases in the forespore [Pubmed|22848659]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B885 (yacP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1884 NBRP B. subtilis, Japan]
  • BKE00970 ([gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTCTTTATTCTCCCA, downstream forward: _UP4_TAAGTTGACGCTTTTTTGCC
  • BKK00970 ([gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTCTTTATTCTCCCA, downstream forward: _UP4_TAAGTTGACGCTTTTTTGCC
  • References

    Reviews

  • 28396493,29557713
  • Original publications

  • 19258532,28363943,17114934