SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


bacterial expansin, binds cellulose, required for the colonization of maize roots
25.49 kDa
protein length
232 aa Sequence Blast
gene length
699 bp Sequence Blast
interaction with plant roots

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.4|Lifestyles/ miscellaneous]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,032,927 2,033,625

    Phenotypes of a mutant

  • strongly reduced ability to colonize maize roots [Pubmed|18971341]
  • The protein

    Protein family

  • expansin [Pubmed|18971341]
  • [SW|Domains]

  • Expansin-like EG45 domain (aa 58-127) (according to UniProt)
  • Structure

  • [PDB|3D30] [Pubmed|18971341]
  • [SW|Localization]

  • extracellular [Pubmed|18971341]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • view in new tab

    Biological materials


  • MGNA-A839 (yoaJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18630 ([gene|17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0|yoaJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGGTCCTCCTCAAA, downstream forward: _UP4_TAAAAAATACGAAACAGCGG
  • BKK18630 ([gene|17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0|yoaJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGGTCCTCCTCAAA, downstream forward: _UP4_TAAAAAATACGAAACAGCGG
  • References


  • 25833181,27365165
  • Original publications

  • 19058186,15604683,16984999,22927418,18971341,21454649,12354229,23053073,24755657,22949138,26521249,26751268,27365165,30221235,31271651,31689330