SubtiBank SubtiBank
yoaJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoaJ

bacterial expansin, binds cellulose, required for the colonization of maize roots
locus
BSU_18630
pI
9.45
mw
25.49 kDa
protein length
232 aa Sequence Blast
gene length
699 bp Sequence Blast
function
interaction with plant roots
product
expansin
essential
no
synonyms
EXLX1

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.4|Lifestyles/ miscellaneous]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,032,927 2,033,625

    Phenotypes of a mutant

  • strongly reduced ability to colonize maize roots [Pubmed|18971341]
  • The protein

    Protein family

  • expansin [Pubmed|18971341]
  • Structure

  • [PDB|3D30] [Pubmed|18971341]
  • [SW|Localization]

  • extracellular [Pubmed|18971341]
  • Expression and Regulation

    Operons

    genes
    [gene|17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0|yoaJ]
    description
    [Pubmed|12354229]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A839 (yoaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/839 NBRP B. subtilis, Japan]
  • BKE18630 ([gene|17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0|yoaJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGGTCCTCCTCAAA, downstream forward: _UP4_TAAAAAATACGAAACAGCGG
  • BKK18630 ([gene|17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0|yoaJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGGTCCTCCTCAAA, downstream forward: _UP4_TAAAAAATACGAAACAGCGG
  • References

    Reviews

  • 25833181,27365165
  • Original publications

  • 19058186,15604683,16984999,22927418,18971341,21454649,12354229,23053073,24755657,22949138,26521249,26751268,27365165,30221235,31271651