SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


major cold-shock protein
7.23 kDa
protein length
gene length
204 bp Sequence Blast
RNA chaperone
major cold-shock protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.2|RNA chaperones]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • Gene

    984,262 984,465

    The protein

    Paralogous protein(s)

  • [protein|D453E1E7D4256B56AFB2149731E08B104D59431B|CspC], [protein|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|CspD]
  • [SW|Domains]

  • [SW|CSD domain] (aa 4-63) (according to UniProt)
  • Structure

  • [PDB|2I5M] [pubmed|17481655]
  • [PDB|2ES2] [Pubmed|16780871]
  • [PDB|1CSP] [Pubmed|8321288]
  • [PDB|1NMG] (NMR)
  • [PDB|3PF4] (in complex with r(GUCUUUA)) [Pubmed|22128343]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot), cytoplasma, colocalizes with the ribosomes [Pubmed|16352840]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1400185], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • induced upon cold shock [Pubmed|12399512]
  • view in new tab

    Biological materials


  • GP1968 (Δ[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]::cat trpC2) available in [SW|Jörg Stülke]'s lab
  • GP3251 (Δ[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]::tet trpC2) available in [SW|Jörg Stülke]'s lab
  • BKE09100 (Δ[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATTTCCTCCTAAAG, downstream forward: _UP4_TAAGCATAAATTGATATGAA
  • BKK09100 (Δ[gene|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|cspB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATTTCCTCCTAAAG, downstream forward: _UP4_TAAGCATAAATTGATATGAA
  • Expression vector

  • Constitutive overexpression of Strep-CspB with pGP3125 (in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [ homepage]
  • References

  • 12399512,12171653,11752341,11717297,12838604,8321289,9533624,9379903,8294017,8755892,9914312,11591689,7476164,1409560,16352840,9920884,1400185,12427936,8307174,7703860,22128343,23199363,15378759,21124848,16780871,26809452,8321288,17481655,30738179,31756296