SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


39.92 kDa
protein length
350 aa Sequence Blast
gene length
1053 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    501,579 502,631

    The protein

    Protein family

  • [SW|autoinducer-2 exporter (AI-2E) (TC 2.A.86) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials


  • MGNA-C117 (ydbI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04480 ([gene|16CCAA5264276AF250B8A3CCC1773E877DC104C4|ydbI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATACACTCCTGTTAG, downstream forward: _UP4_TAGTTTAAAATCGAATAATG
  • BKK04480 ([gene|16CCAA5264276AF250B8A3CCC1773E877DC104C4|ydbI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATACACTCCTGTTAG, downstream forward: _UP4_TAGTTTAAAATCGAATAATG
  • References

  • 21630458