SubtiBank SubtiBank
ydbI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydbI

unknown
locus
BSU_04480
pI
9.61
mw
39.92 kDa
protein length
350 aa Sequence Blast
gene length
1053 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    501,579 502,631

    The protein

    Protein family

  • [SW|autoinducer-2 exporter (AI-2E) (TC 2.A.86) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C117 (ydbI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2115 NBRP B. subtilis, Japan]
  • BKE04480 ([gene|16CCAA5264276AF250B8A3CCC1773E877DC104C4|ydbI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATACACTCCTGTTAG, downstream forward: _UP4_TAGTTTAAAATCGAATAATG
  • BKK04480 ([gene|16CCAA5264276AF250B8A3CCC1773E877DC104C4|ydbI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATACACTCCTGTTAG, downstream forward: _UP4_TAGTTTAAAATCGAATAATG
  • References

  • 21630458