SubtiBank SubtiBank
ydgH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydgH

similar to drug exporter
locus
BSU_05650
pI
5.14
mw
95.29 kDa
protein length
885 aa Sequence Blast
gene length
2658 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    609,388 612,045

    The protein

    Protein family

  • resistance-nodulation-cell division (RND) (TC 2.A.6) family (with [protein|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|YdfJ] and [protein|AAC32230E3E585932A876737131C3E2C15168B2A|SwrC], according to UniProt)
  • Structure

  • [PDB|6AJF] (from Mycobacterium smegmatis, corresponds to aa 2 ... 370 and 686 ... 885, 24% identity) [pubmed|30682372]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|833F4B9ECB609D5EBAD0CAA55E1F601A5C1C3787|ydgG]-[gene|1632474628BEA113F297897D152276A1AB73BAE8|ydgH]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C161 (ydgH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2159 NBRP B. subtilis, Japan]
  • BKE05650 ([gene|1632474628BEA113F297897D152276A1AB73BAE8|ydgH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCACTTGAATTTGATGATTG, downstream forward: _UP4_TAATCGAGAGAAGAGTGATG
  • BKK05650 ([gene|1632474628BEA113F297897D152276A1AB73BAE8|ydgH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCACTTGAATTTGATGATTG, downstream forward: _UP4_TAATCGAGAGAAGAGTGATG
  • References

  • 16267290,21630458,30682372